Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6135944
End position: 6135970
Length: 27

DNA sequence
>NC_013739, from 6135944 to 6135970 (27 bp); Conexibacter woesei DSM 14684 CCCCGGTCCCACCGGTCCCCCCGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6135480-6138701	Sequence	Cwoe_5731 - Integrin alpha beta-propellor repeat protein (Protein is coded in complementary strand; from 6138701 to 6135480)