Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6155673
End position: 6155696
Length: 24

DNA sequence
>NC_013739, from 6155673 to 6155696 (24 bp); Conexibacter woesei DSM 14684 CTCGTCCTCGTCCTCGGCCTCGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6155467-6156984	Sequence	Cwoe_5750 - sulfatase (Protein is coded in complementary strand; from 6156984 to 6155467)