Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6177806
End position: 6177850
Length: 45

DNA sequence
>NC_013739, from 6177806 to 6177850 (45 bp); Conexibacter woesei DSM 14684 GCGAGCGCCGCGACGGCGGACGCGGCGACGGCGAGCGCCGCTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6177086-6177883	Sequence	Cwoe_5774 - nuclear export factor GLE1 (Protein is coded in complementary strand; from 6177883 to 6177086)