Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6183151
End position: 6183183
Length: 33

DNA sequence
>NC_013739, from 6183151 to 6183183 (33 bp); Conexibacter woesei DSM 14684 AGGCGCGGCGCACGAGCGGCGCGGGCGCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6182685-6183794	Sequence	Cwoe_5780 - alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 6183794 to 6182685)