Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 621316
End position: 621351
Length: 36

DNA sequence
>NC_013739, from 621316 to 621351 (36 bp); Conexibacter woesei DSM 14684 CGGCGAACGAGACGGCGAACATGACGGCGAAGTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 621042-622175	Sequence	Cwoe_0589 - arsenic resistance protein (Protein is coded in complementary strand; from 622175 to 621042)