Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6263186
End position: 6263210
Length: 25

DNA sequence
>NC_013739, from 6263186 to 6263210 (25 bp); Conexibacter woesei DSM 14684 GCGGCGCGACGCGGCGCAGCGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6262744-6263634	Sequence	Cwoe_5847 - MerR family transcriptional regulator (Protein is coded in complementary strand; from 6263634 to 6262744)