Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 6347464
End position: 6347487
Length: 24

DNA sequence
>NC_013739, from 6347464 to 6347487 (24 bp); Conexibacter woesei DSM 14684 CGCGAGCGCCAGCGCGAACGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6347201-6349036	Sequence	Cwoe_5936 - hypothetical protein (Protein is coded in complementary strand; from 6349036 to 6347201)