Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 777959
End position: 777988
Length: 30

DNA sequence
>NC_013739, from 777959 to 777988 (30 bp); Conexibacter woesei DSM 14684 CGATCACGAGCACGATCACGATCGCGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 776905-778077	Sequence	Cwoe_0731 - sodium ANB transporter permease (Protein is coded in complementary strand; from 778077 to 776905)