Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 802452
End position: 802487
Length: 36

DNA sequence
>NC_013739, from 802452 to 802487 (36 bp); Conexibacter woesei DSM 14684 CGTCGAGCGCGACGGCGACCGCGACGCCGAGCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 802043-802717	Sequence	Cwoe_0760 - ion transport 2 domain protein (Protein is coded in complementary strand; from 802717 to 802043)