Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 804532
End position: 804555
Length: 24

DNA sequence
>NC_013739, from 804532 to 804555 (24 bp); Conexibacter woesei DSM 14684 CGCGGTCGTGGTCGTGGTCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 804469-805083	Sequence	Cwoe_0762 - ECF subfamily RNA polymerase sigma-24 subunit