Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 882956
End position: 882982
Length: 27

DNA sequence
>NC_013739, from 882956 to 882982 (27 bp); Conexibacter woesei DSM 14684 GCGGCCGCGGCGACCGCGGCCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 881150-883015	Sequence	Cwoe_0841 - NHL repeat containing protein (Protein is coded in complementary strand; from 883015 to 881150)