Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 905424
End position: 905450
Length: 27

DNA sequence
>NC_013739, from 905424 to 905450 (27 bp); Conexibacter woesei DSM 14684 CCGATCCGGACGATCCGGACGATCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 905169-906062	Sequence	Cwoe_0861 - ECF subfamily RNA polymerase sigma-24 subunit