Sequence retrieval

Genome: Conexibacter woesei DSM 14684
Start position: 944988
End position: 945014
Length: 27

DNA sequence
>NC_013739, from 944988 to 945014 (27 bp); Conexibacter woesei DSM 14684 GTTGATCGCGTTCATCGCGTCGATCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 944665-945141	Sequence	Cwoe_0901 - hypothetical protein (Protein is coded in complementary strand; from 945141 to 944665)