Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1027383
End position: 1027406
Length: 24

DNA sequence
>NC_013895, from 1027383 to 1027406 (24 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TACAGTTATAGTTACGGTTACGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1027005-1028774	Sequence	HMPREF0868_0764 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 1028774 to 1027005)