Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1069381
End position: 1069404
Length: 24

DNA sequence
>NC_013895, from 1069381 to 1069404 (24 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TCAGGATCAGGATCAGCATCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1068561-1070357	Sequence	HMPREF0868_0725 aspS aspartate--tRNA ligase (Protein is coded in complementary strand; from 1070357 to 1068561)