Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1521743
End position: 1521766
Length: 24

DNA sequence
>NC_013895, from 1521743 to 1521766 (24 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GCTCAGGCTCAGGCTCAGGCTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1519532-1523542	Sequence	HMPREF0868_0321 - carbohydrate binding domain-containing protein (Protein is coded in complementary strand; from 1523542 to 1519532)