Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1642712
End position: 1642735
Length: 24

DNA sequence
>NC_013895, from 1642712 to 1642735 (24 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TGACCTTGAGCTTGAGCTTGACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1641495-1648532	Sequence	HMPREF0868_0231 - hypothetical protein (Protein is coded in complementary strand; from 1648532 to 1641495)