Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1808696
End position: 1808719
Length: 24

DNA sequence
>NC_013895, from 1808696 to 1808719 (24 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CTGCCTCTGCCTTTGCCTTTGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1807199-1809004	Sequence	HMPREF0868_0095 pepF_2 oligoendopeptidase F (Protein is coded in complementary strand; from 1809004 to 1807199)