Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1168841
End position: 1168867
Length: 27

DNA sequence
>NC_013895, from 1168841 to 1168867 (27 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TAATGAACGTAACGAACGTAATGAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1168694-1169563	Sequence	HMPREF0868_0629 folD tetrahydrofolate dehydrogenase/cyclohydrolase (Protein is coded in complementary strand; from 1169563 to 1168694)