Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1417865
End position: 1417891
Length: 27

DNA sequence
>NC_013895, from 1417865 to 1417891 (27 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CGCATCTGGCGCATCTGGCGCATCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1416976-1417953	Sequence	HMPREF0868_0402 - putative 2-dehydropantoate 2-reductase