Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1551238
End position: 1551264
Length: 27

DNA sequence
>NC_013895, from 1551238 to 1551264 (27 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TCATAGTCATCATAGCCATCATCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1550200-1551864	Sequence	HMPREF0868_0301 - ABC transporter permease (Protein is coded in complementary strand; from 1551864 to 1550200)