Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1721562
End position: 1721588
Length: 27

DNA sequence
>NC_013895, from 1721562 to 1721588 (27 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CCGTTGTTGCCGTTGCTGCCGTTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1720895-1722301	Sequence	HMPREF0868_0182 - ABC transporter permease (Protein is coded in complementary strand; from 1722301 to 1720895)