Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1800464
End position: 1800490
Length: 27

DNA sequence
>NC_013895, from 1800464 to 1800490 (27 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CGCCGTTCGCGCCGTTCGCACCGTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1799360-1801015	Sequence	HMPREF0868_0101 - putative dGTPase (Protein is coded in complementary strand; from 1801015 to 1799360)