Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 231515
End position: 231541
Length: 27

DNA sequence
>NC_013895, from 231515 to 231541 (27 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CGGCGGCACCGGTGGCACCGGCGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 229974-231992	Sequence	HMPREF0868_1505 metG methionine--tRNA ligase