Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 285654
End position: 285680
Length: 27

DNA sequence
>NC_013895, from 285654 to 285680 (27 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GCAACAACGGCAACAATGCCAACAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 284904-285713	Sequence	HMPREF0868_1449 rpiA ribose 5-phosphate isomerase A