Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 303018
End position: 303044
Length: 27

DNA sequence
>NC_013895, from 303018 to 303044 (27 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TGTTTAAGATGTTTAAGATGTTTAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 301089-303125	Sequence	HMPREF0868_1434 - V-type ATPase 116kDa subunit family protein