Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 514803
End position: 514829
Length: 27

DNA sequence
>NC_013895, from 514803 to 514829 (27 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TAATATTAATGATATTAATGATATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 514555-515010	Sequence	HMPREF0868_1236 nusB transcription antitermination factor NusB