Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 781913
End position: 781939
Length: 27

DNA sequence
>NC_013895, from 781913 to 781939 (27 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GCGGAATGACCGGAATGACCGGAATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 781787-783970	Sequence	HMPREF0868_0973 - DNA gyrase/topoisomerase IV subunit A