Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1444535
End position: 1444562
Length: 28

DNA sequence
>NC_013895, from 1444535 to 1444562 (28 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 AGTCATCAGTCATCAGTCGTCAGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1443482-1444672	Sequence	HMPREF0868_0378 - extracellular solute-binding protein (Protein is coded in complementary strand; from 1444672 to 1443482)