Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 780313
End position: 780340
Length: 28

DNA sequence
>NC_013895, from 780313 to 780340 (28 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 ATAACGGATAGCGGATAGCGGATAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 779785-781773	Sequence	HMPREF0868_0974 - DNA gyrase subunit B, C-terminal domain-containing protein