Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 11168
End position: 11197
Length: 30

DNA sequence
>NC_013895, from 11168 to 11197 (30 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CAAATACAAGTACAAACACAAGTACAAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 11050-11535	Sequence	HMPREF0868_0081 - NUDIX family hydrolase (Protein is coded in complementary strand; from 11535 to 11050)