Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1243070
End position: 1243099
Length: 30

DNA sequence
>NC_013895, from 1243070 to 1243099 (30 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GGACGATGCGAGACGGTGCGGGACAGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1241780-1243516	Sequence	HMPREF0868_0571 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 1243516 to 1241780)