Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1248809
End position: 1248838
Length: 30

DNA sequence
>NC_013895, from 1248809 to 1248838 (30 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 ACAAATTTCAACAAATGACAACAAATTACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1248638-1250164	Sequence	HMPREF0868_0566 - family 5 extracellular solute-binding protein (Protein is coded in complementary strand; from 1250164 to 1248638)