Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1313983
End position: 1314012
Length: 30

DNA sequence
>NC_013895, from 1313983 to 1314012 (30 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CTTATGCTTTATTATGCCTTTTTACGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1312645-1314219	Sequence	HMPREF0868_0498 - putative tetrahydrofolate synthase (Protein is coded in complementary strand; from 1314219 to 1312645)