Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 812218
End position: 812247
Length: 30

DNA sequence
>NC_013895, from 812218 to 812247 (30 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 ACTTATTTGAACTCATTTGAACTTATTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 811272-813341	Sequence	HMPREF0868_0951 - LPXTG-motif cell wall anchor domain-containing protein