Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1285600
End position: 1285632
Length: 33

DNA sequence
>NC_013895, from 1285600 to 1285632 (33 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GCCGCGACTGAGGCTCGACTGAGCTGTGACTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1285138-1287348	Sequence	HMPREF0868_0531 nrdD anaerobic ribonucleoside-triphosphate reductase (Protein is coded in complementary strand; from 1287348 to 1285138)