Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1396784
End position: 1396816
Length: 33

DNA sequence
>NC_013895, from 1396784 to 1396816 (33 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TATGTTCTAATTATGTTTTAATTATGCTTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1396451-1397407	Sequence	HMPREF0868_0417 - hypothetical protein (Protein is coded in complementary strand; from 1397407 to 1396451)