Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1756675
End position: 1756707
Length: 33

DNA sequence
>NC_013895, from 1756675 to 1756707 (33 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 AGTTTGTTTGCAGTTTGTATGCAGTTTGTTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1754313-1757465	Sequence	HMPREF0868_0147 - hypothetical protein (Protein is coded in complementary strand; from 1757465 to 1754313)