Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1121918
End position: 1121953
Length: 36

DNA sequence
>NC_013895, from 1121918 to 1121953 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GGCCGTTAGCTTGGCCGTTGACTTGGCCGTGAGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1120982-1122325	Sequence	HMPREF0868_0667 dsdA D-serine ammonia-lyase (Protein is coded in complementary strand; from 1122325 to 1120982)