Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1143788
End position: 1143823
Length: 36

DNA sequence
>NC_013895, from 1143788 to 1143823 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 AATGGTTTGCTCATTGCTTTGCTCATTGCTTTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1142000-1144657	Sequence	HMPREF0868_0649 valS valine--tRNA ligase (Protein is coded in complementary strand; from 1144657 to 1142000)