Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1218863
End position: 1218898
Length: 36

DNA sequence
>NC_013895, from 1218863 to 1218898 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CCGGTGGAGTTTCCGGTGGAGTTCCCGGCGGAGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1218041-1219069	Sequence	HMPREF0868_0591 etfA electron transfer flavoprotein (Protein is coded in complementary strand; from 1219069 to 1218041)