Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1264186
End position: 1264221
Length: 36

DNA sequence
>NC_013895, from 1264186 to 1264221 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 ATTCATCATTTTATCAATCATTTTATCAATCATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1264152-1264346	Sequence	HMPREF0868_0553 - hypothetical protein (Protein is coded in complementary strand; from 1264346 to 1264152)