Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1542114
End position: 1542149
Length: 36

DNA sequence
>NC_013895, from 1542114 to 1542149 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CCGATGACGGAGCCGACGACGAAGCCGACGACGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1540566-1542455	Sequence	HMPREF0868_0310 - hypothetical protein (Protein is coded in complementary strand; from 1542455 to 1540566)