Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1544151
End position: 1544186
Length: 36

DNA sequence
>NC_013895, from 1544151 to 1544186 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CATCCGCTTTCACATCCGCATCCACATCCGCTTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1543859-1544638	Sequence	HMPREF0868_0308 - response regulator receiver domain-containing protein (Protein is coded in complementary strand; from 1544638 to 1543859)