Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1590163
End position: 1590198
Length: 36

DNA sequence
>NC_013895, from 1590163 to 1590198 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TTTCTTTCTTCATAACTTTCTTCATTTCTCTCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1589122-1590444	Sequence	HMPREF0868_0276 xylA xylose isomerase (Protein is coded in complementary strand; from 1590444 to 1589122)