Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1665950
End position: 1665985
Length: 36

DNA sequence
>NC_013895, from 1665950 to 1665985 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GCATCCGGGTTCGCATCCGGCTTAGTATCCGGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1665501-1666502	Sequence	HMPREF0868_0221 - ABC transporter permease (Protein is coded in complementary strand; from 1666502 to 1665501)