Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1678631
End position: 1678666
Length: 36

DNA sequence
>NC_013895, from 1678631 to 1678666 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CTTAGTGTTTGCCTTAATGTTTCCCTTAATGTTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1678512-1679339	Sequence	HMPREF0868_0209 - putative ferrichrome ATP binding cassette transporter, ABC protein FhuC