Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1712859
End position: 1712894
Length: 36

DNA sequence
>NC_013895, from 1712859 to 1712894 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TCTCAGCCGTTGTCTCAGCTGCTGCTTCAGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1710754-1717074	Sequence	HMPREF0868_0187 - hypothetical protein (Protein is coded in complementary strand; from 1717074 to 1710754)