Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1731594
End position: 1731629
Length: 36

DNA sequence
>NC_013895, from 1731594 to 1731629 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CCTCCCGGCGTTACTCCCGGCGTTACTCCCGGCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1729825-1731702	Sequence	HMPREF0868_0178 - hypothetical protein (Protein is coded in complementary strand; from 1731702 to 1729825)