Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1772178
End position: 1772213
Length: 36

DNA sequence
>NC_013895, from 1772178 to 1772213 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TCTTTCATATTTGCTTTCGTATTTTCTTTCATATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1771836-1772300	Sequence	HMPREF0868_0128 - GNAT family acetyltransferase (Protein is coded in complementary strand; from 1772300 to 1771836)